October 4, 2025 9 min to read

Viewing File Contents in Bioinformatics

Master Essential Commands for Inspecting Sequence Data and Text Files

Setting Up Your Workspace

Before we begin, ensure you’re in the correct directory:

cd data_for_bash_essentials
pwd  # Verify your current location

Note: Your path may differ depending on where you saved the data. The pwd command should confirm you’re in the data_for_bash_essentials directory before proceeding.

Quick Peeks: The head and tail Commands

Using head to View the Beginning of Files

The head command displays the first few lines of a file—perfect for quickly checking file structure without opening the entire file.

Basic usage:

head reference.fasta

>1
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

By default, head prints the first 10 lines. You can customize this with the -n flag:

head -n 4 reference.fasta

This command shows only the first 4 lines, useful when you need a quick glimpse of file headers or format.

Example output:

>1
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Using tail to View the End of Files

The tail command works similarly but displays the last lines of a file—helpful for checking if files are complete or viewing summary statistics often placed at file ends.

Basic usage:

tail reference.fasta
tail -n 4 reference.fasta

Pro tip: Both head and tail work with various file types including FASTA, TSV, and text files.

Interactive Viewing: The less Command

What is less?

The less command opens files in an interactive viewer, allowing you to navigate through large files efficiently without loading them entirely into memory. This is invaluable for bioinformatics files that can be gigabytes in size.

Using less with Plain Text Files

Let’s view the reference FASTA file:

less reference.fasta

Navigation Controls

Once inside the less viewer:

⚠️ Important: Press q to exit the viewer. If you don’t know this, you’ll be stuck in the viewer!

Why less is Useful

• Memory efficient: Doesn’t load entire file into RAM
• Fast navigation: Quickly jump to different sections
• Search capability: Find specific patterns in large files
• No file modification: View-only mode prevents accidental changes

Viewing text files with vi

You can also use vi to view text files. vi is a text editor that is available on almost all Unix systems. To open a file with vi, use the following command:

Before running the command that I am going to share you next. Please read the following important note.

Important: vi is a powerful text editor, but it can be a bit tricky for beginners. As it was for me as well, when I openeded the file in vi for the first time, I didn’t know how to exit and I had to force quit the terminal. So, please make sure to read the instructions below on how to exit vi before running the command.

Navigation in vi is done in two modes: command mode and insert mode. When you first open a file, you are in command mode. To switch to insert mode, press i. In insert mode, you can type and edit the file. To switch back to command mode, press Esc.

To exit vi, follow these steps:

1. Press Esc to ensure you are in command mode.
2. Type :q and press Enter to quit if you haven’t made any changes.
3. If you have made changes and want to save them, type :wq and press Enter.
4. If you want to quit without saving changes, type :q! and press Enter.

Now we are ready to open the file:

vi reference.fasta

You can navigate the file using the arrow keys. To exit, follow the instructions above.

cat: Viewing File Contents

The cat command is another way to view the contents of a file. It prints the entire file to the screen. This is useful for small files, but not recommended for large files as it will flood your terminal with text.

cat testing.txt

Before we moce on to next topic I want to share small history of cat command. The cat command was originally developed in the early days of Unix as a simple way to concatenate and display files. The name “cat” is short for “concatenate,” which reflects its primary function of joining multiple files together. Over time, cat has become a staple command in Unix-like operating systems, widely used for viewing and manipulating text files.

Let’s try opening multiple testing files with cat:

cat testing.txt testing1.txt testing2.txt

You should see the contents of all three files printed to the screen, one after the other.

This is testing.txt
This is testing1.txt
This is testing2.txt

You saw the text in the file. There is one way to open big files with cat without flooding your terminal. You can use the | (pipe) operator to send the output of cat to another command, like less. But we will see more about pipes in a later lesson. For now, just remember that you can use cat to view small files.

The Compressed File Challenge

Now let’s try viewing a compressed FastQ file:

head tiny_n_L001_R1_xxx.fastq.gz

What happened? You’ll see garbled, unreadable output on your screen. This occurs because the file is gzip-compressed—the data is encoded in a binary format that humans can’t read directly.

Example of garbled output:

�^?�<8D>^M�^@^@^@^@^@^@^@^@^@ÿÿì½^Gy\T^W.þ<9e>÷<9e>of<9e>Ö^T...

This is normal! Compressed files require special tools to view properly.

We can try to open the compressed file with less as well:

less tiny_n_L001_R1_xxx.fastq.gz

You will see the following warning:

"tiny_n_L001_R1_xxx.fastq.gz" may be a binary file.  See it anyway?

If you hit Enter, it will exit less and return you to the command line. If you type y you will see garbled output again as with head. If you hit q, you’ll exit back to the command line.

Viewing Compressed Files: The zless Command

For compressed files (.gz extension), use zless—it decompresses on-the-fly and displays content in the same interactive viewer:

zless tiny_n_L001_R1_xxx.fastq.gz

Now you can properly view the FastQ file contents:

@M00969:353:000000000-BR5KF:1:1101:15446:1444 1:N:0:TAAGGCGA+TAGATCGC
NTTGTATTGCTAGCAATACTGCAACAAATGCTATGAATGCATGCAACAATGTTGCAATGC
+
#8BCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG

Navigation: Use the same keyboard shortcuts as less (q to quit).

zcat: Viewing Entire Compressed Files

If you want to view the entire contents of a compressed file without interaction, use zcat:

zcat tiny_n_L001_R1_xxx.fastq.gz

This command do not work in macOS by default. But as I suggested you can use the alternative commands suggested earlier.

Command Comparison Table

Quick Inspection Workflows

Checking File Format

head -n 1 myfile.fasta  # See FASTA header
head -n 4 myfile.fastq  # See one FastQ record

Verifying File Completeness

tail -n 2 results.tsv  # Check if analysis finished

Exploring Large Files

zless large_dataset.fastq.gz  # Navigate compressed data

Common Questions

Q: What if I want just a few lines from a compressed file?
A: Great question! We’ll learn about zcat and zgrep in the next lesson for extracting specific lines from compressed files.

Q: Can I edit files with less?
A: No, less is view-only. Use text editors like nano or vim for editing.

Practice Exercise

Try these commands with your dataset:

1. View the first 20 lines of reference.fasta
2. Check the last 5 lines of a TSV file
3. Navigate through a compressed FastQ file using zless

What’s Next?

In Lesson 06, we’ll explore:

• copying, moving, renaming and deleting files.
• We will also look at standard output and how to redirect output to files. Stay tuned and keep practicing these essential commands! —

Key Takeaways

✓ head and tail provide quick peeks at file beginnings and ends
✓ less offers interactive navigation for large files
✓ zless works identically to less but handles compressed files
✓ Press q to exit less and zless viewers
✓ These commands don’t load entire files into memory—perfect for big data.